Repositório RCAAP

The kinetics of oxygen consumption related to mineralisation of 18 taxa of aquatic macrophytes (Cyperus sp, Azolla caroliniana, Echinodorus macrophyllus, Eichhornia azurea, Eichhornia crassipes, Eleocharis sp1, Eleocharis sp2, Hetereanthera multiflora, Hydrocotyle raniculoides, Ludwigia sp, Myriophyllum aquaticum, Nymphaea elegans, Oxycaryum cubense, Ricciocarpus natans, Rynchospora corymbosa, Salvinia auriculata, Typha domingensis and Utricularia foliosa) from the reservoir of Piraju Hydroelectric Power Plant (São Paulo state, Brazil) were described. For each species, two incubations were prepared with ca. 300.0 mg of plant (DW) and 1.0 L of reservoir water sample. The incubations were maintained in the dark and at 20 ºC. Periodically the dissolved oxygen (DO) concentrations were measured; the accumulated DO values were fitted to 1st order kinetic model and the results showed that: i) high oxygen consumption was observed for Ludwigia sp (533 mg g-1 DW), while the lowest was registered for Eleocharis sp1 (205 mg g-1 DW) mineralisation; ii) the higher deoxygenation rate constants were verified in the mineralisation of A. caroliniana (0.052 day-1), H. raniculoides (0.050 day-1) and U. foliosa (0.049 day-1). The oxygen consumption rate constants of Ludwigia sp and Eleocharis sp2 mineralisation (0.027 day-1) were the lowest. The half-time of oxygen consumption varied from 9 to 26 days. In the short term, the detritus of E. macrophyllus, H. raniculoides, Ludwigia sp, N. elegans and U. foliosa were the critical resources to the reservoir oxygen demand; while in the long term, A. caroliniana, H. multiflora and T. domingensis were the resources that can potentially contribute to the benthic oxygen demand of this reservoir.

The increasing release of untreated fish farming effluents into water courses that flow to the Pantanal wetlands in Mato Grosso (Brazil) may drive this ecosystem to eutrophication. Therefore, the growth of Azolla caroliniana Willd. and Salvinia auriculata Aubl. in fish farming effluent and their effect on its quality were evaluated for 48 days in a greenhouse. The results were compared to those obtained in a nutrient rich solution (Hoagland ½ medium). Azolla caroliniana showed lower relative growth rate in fish farming effluent (0.020 d-1) than in Hoagland ½ medium (0.029 d-1). However, S. auriculata grew slightly better in fish farming effluent (0.030 d-1) than in Hoagland ½ medium (0.025 d-1). The species apparently contributed to reduce nitrate and phosphate concentration in Hoagland ½ medium. However, in fish farming effluent, only electrical conductivity and pH were reduced by plants compared to the control without plants. Thus, A. caroliniana and S. auriculata show low potential for improving effluent quality.

We report on the richness of galling insects in the altitudinal wetland forests of Pernambuco State, Northeastern Brazil. We found 80 distinct types of insect galls on 49 species of host plants belonging to 28 families and 35 genera. Most of the galled plant species belong to Nyctaginaceae, Fabaceae, Meliaceae, Sapindaceae and Myrtaceae. The most common gall were spheroid and globoid; most galls were glabrous, predominantly green and with one chamber, and on the leaves. Most galls were induced by Cecidomyiidae (Diptera). The results of this study contribute to existing knowledge richness of galling insects and host-plant diversity in the altitudinal wetland forests of Northeastern Brazil.

This study concerns the kinetics of bacterial degradation of two fractions (molecular mass) of dissolved organic matter (DOM) released by Microcystis aeruginosa. Barra Bonita Reservoir (SP, Brazil) conditions were simulated in the laboratory using the associated local bacterial community. The extent of degradation was quantified as the amount of organic carbon transferred from each DOM fraction (< 3 kDa and 3-30 kDa) to bacteria. The variation of bacteria morphotypes associated with the decomposition of each fraction was observed. To find the degradation rate constants (kT), the time profiles of the total, dissolved and particulate organic carbon concentrations were fitted to a first-order kinetic model. These rate constants were higher for the 3-30 kDa fraction than for the lighter fraction. Only in the latter fraction the formation of refractory dissolved organic carbon (DOC R) compounds could be detected and its rate of mass loss was low. The higher bacterial density was reached at 24 and 48 hours for small and higher fractions, respectively. In the first 48 hours of decomposition of both fractions, there was an early predominance of bacillus, succeeded by coccobacillus, vibrios and coccus, and from day 5 to 27, the bacterial density declined and there was greater evenness among the morphotypes. Both fractions of DOM were consumed rapidly, corroborating the hypothesis that DOM is readily available in the environment. This also suggests that the bacterial community in the inocula readily uses the labile part of the DOM, until this community is able to metabolise efficiently the remaining of DOM not degraded in the first moment. Given that M. aeruginosa blooms recur throughout the year in some eutrophic reservoirs, there is a constant supply of the same DOM which could maintain a consortium of bacterial morphotypes adapted to consuming this substrate.

The Plant Vigor Hypothesis (PVH) predicts an oviposition preference of females and higher offspring performance for insect herbivores on longer and fast-growing plant modules. We tested the PVH predictions by investigating the effects of leaf size of Miconia prasina (Sw.) DC. (Melastomataceae) on the oviposition preference and on the offspring survival of the gall-inducing weevil Prospoliata bicolorata (Coleoptera: Curculionidae). Additionally, we analysed the effects of top-down mortality force on this system. Approximately 83% of the developed galls resulted in adults of P. bicolorata, whereas 17% of the galls successfully induced were killed by natural enemies (top-down effect). Leaves of intermediate size were more abundant while smaller and longer leaves were rare. Nevertheless, the percentage of P. bicolorata galls was higher on the smallest leaves of M. prasina, refuting the preference prediction of the PVH. Our results also refuted the performance prediction: the ratio of survival per leaf was negatively related to the leaf length. Thus, we found a link between female preference and larval performance of P. bicolorata on small-sized leaves of M. prasina. The next goal is to understand the mechanisms involved in the selection of gall-inducing weevil on short leaves of its host plant.

This study aimed to evaluate the isotopic fractionation and trophic position of three zooplankton species (Notodiaptomus amazonicus, Moina minuta and Bosmina hagmanni) in the Upper Paraná River floodplain. We predict that phytoplankton is the main food resource used by these species. Three zooplankton samples and three phytoplankton samples were taken from each sampling site, with three to four samples collected for each species. The number of individuals for samples varied according to the body size: from 100 to 130 individuals for Notodiaptomus amazonicus; 150 to 200 for Moina minuta; and from 250 to 300 for Bosmina hagmanni. The isotopic values for δ13C and δ15N were determined using mass spectrophotometer. The isotopic fractionation of 13C was performed according to the relationship Δ = δ13Czooplankton - δ13C phytoplankton. To determine the possible trophic position of these species, we used the expression TL = (δ15N zooplankton - δ15N phytoplankton)/Δ+ 1. The species showed high variation in isotopic fractionation and in trophic position in the different environments. We verified that the species use other food resources in addition to phytoplankton. The elucidation and understanding of the trophic position of the organisms based on stable isotopic analysis offers complementary information to traditional techniques. This analysis helps explain the flow of matter and energy in the food chain of floodplain aquatic environments as well as trace the trophic relationships involved in the ecological roles and strategies of distinct species.

This study focuses on metals analysis in kidney and liver tissues of Egretta thula which were collected prostrate or newly dead in Coroa Grande mangrove, Sepetiba Bay, Rio de Janeiro, Brazil, between March 2005 and October 2008. Kidney and liver were collected and analysed to evaluate heavy metal pollution. High values and widest range were detected for all metals in liver and kidney tissues. Geometric mean differences from metals concentrations for Zn, Cd, Ni, Pb, Cu, and Cr, respectively, were found in both organs. Results from linear regression analysis were non-significant in kidney (r = -0.79975, P = 0.10428), and in liver (r = -0.53193, P = 0.35618). With ANOVA analysis for metal accumulation differences (kidney*liver), at the 0.05 level, the results were significantly different (F = 33.17676, P = 0.00000; F = 12.47880, P = 0.00000). These results indicate that Sepetiba Bay shows worrying levels of metals in this study with E. thula, showing potential power of widespread biological and mutagenic adverse effects in trophic levels, and therefore, signalling risk to human health.

The feeding habits of the shortnose guitarfish, Zapteryx brevirostris, were studied based on 382 specimens from the northern São Paulo coast, southeast Brazil. The diet showed a predominance of crustaceans (carideans and amphipods), polychaete annelids, and occasionally small fish, sipunculids, and cephalopods. The diets of males and females were similar; however, differences in the proportion of prey items were found among juveniles, subadults, and adults. Differences in the ingestion of prey items were found during the year, probably influenced by oceanographic parameters, although in general, the species feeds mostly on crustaceans and polychaetes.

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

The rainbow runner, Elagatis bipinnulata, which belongs to the Carangidae family, has a circumtropical distribution. It is found throughout the Atlantic Ocean, from Massachusetts (USA) to Bahia (Brazil). The reproductive biology of the rainbow runner was studied, using specimens captured off the São Pedro and São Paulo Archipelago. From July 1999 to November 2003, a total of 352 fishes were analysed (201 females and 151 males). Fork length (FL) was measured and specimens were gutted for gonads collection. In the laboratory, gonads length, width and weight were measured, and sexes identified macroscopically. Through histological analysis, five different maturation stages were identified for females: immature, maturing, mature, spent and resting. A predominance of maturing and mature females was observed from January to May. The highest gonad index (GI) values were also observed during this period, ranging from 7.7 to 55. Mean sexual maturity size (L50) for females was estimated at 64.6 cm (FL). In the studied area the species exhibited total spawning, with two synchronous groups. Testicles were histologically very similar making them impossible to differentiate sexual maturation stages. Considerable variation was observed in the male gonads weight, hampering the assessment of size at maturity. However, GI values for males were also higher from January to May. These results suggest that the spawning period of the rainbow runner in the São Pedro and São Paulo Archipelago occurs during the first semester of the year.

Previous studies have shown the superior competitive ability of honeybees compared with native bees in the exploitation of floral resources and nesting sites besides their low efficiency in pollinating native plant species. However, there is little evidence of the effect of this invading species on autochthonous plant populations in natural environments. Thus experiments were performed to test the pollination efficiency of honeybees in two species of Jatropha (Euphorbiaceae), J. mollissima (Pohl) Baill. and J. mutabilis (Pohl) Baill., after a single flower visitation. Samplings were carried out between March and April 2006 in a hyperxerophilous shrub-arboreal Caatinga at Estação Biológica de Canudos, Bahia (9º 56´ 34" S, 38º 59´ 17" W), the property of Fundação Biodiversitas. Apis mellifera was efficient at pollinating J. mollissima (100%) and J. mutabilis (85%). This high efficiency may be explained by 1) the simple floral characteristics of both plant species, which facilitate access to the sexual organs of the plant; and 2) the body size of A. mellifera that fits the flower's dimensions.

Alcohol consumption compromises bone tissue, and thus may either impair or stop the fixation and maintenance of osseointegrated implants. To evaluate the effects of 5% and 15% ethanol on bone neoformation around porous hydroxiapatite implants. Fifteen rats were separated into 3 groups of 5 animals each: control (CT); 5% alcohol (A); and 15% alcohol (AA). After four weeks of ethanol consumption, the rats received porous hydroxiapatite implants into surgically made cavities in the femur. After surgery, the animals continued to consume ethanol until day 90 of the experiment, when they were euthanised and their femurs removed for histological processing. Bone tissue was found around the ceramic specimens of all the animals. The largest volume of neoformed bone around ceramic specimens occurred in the CT group, and the smallest in the AA group, followed by the A group. It was concluded that ethanol consumption produced a negative effect on osteogenesis around hydroxyapatite implants. Even small doses, such as the 5% ethanol dilution can interfere with bone repair.

The aim of this work is to assess the morphological characteristics and parameters of biomass production, such as fresh and dry matter weight (FMW and DMW, g/plant), yield of dry matter (YDM) in terms of ton/ha, essential oil content (EOC, mL/100 g) and yield of essential oils (YEO) expressed as L/ha of the following plants Salvia verbenaca, Salvia argentea, Salvia lavandulifolia, Salvia pratensis, Salvia sclarea, Salvia triloba and Salvia officinalis. Except for Salvia argentea (S2) all other species have adapted to the south Brazilian climate conditions, with morphological differences among the species evaluated. In terms of DMW and YDM, S. officinalis was found to be the most productive species with 445.83 g/plant and 11.14 ton/ha. The higher essential oil content and yield was observed for S. officinalis, affording 1.99 mL/100 g and 221.74 L/ha, respectively. Chemical characterisation of the essential oils obtained from hydrodistillation was performed through GC and GC/MSD analyses, which revealed for most of the species studied, α e &#946;-thujone, camphor and 1,8-cineole as major compounds, apart from S. sclarea, for which linalool, linalyl acetate and α-terpineol were the major components.

This study describes the accumulation of Hg and metallothionein gene expression in Litopenaeus vannamei Boone, 1931 with aquafeeds as the major source of Hg. Trials were conducted under controlled conditions in experimental tank facilities with high (indoor tanks) and low (outdoor tanks) Hg aquafeeds concentrations. Aquafeeds were the sole source of Hg for the shrimps and concentrations varied from 5.4 to 124 ng.g-1 d.w.. In the three animal fractions analysed; muscle (6,3 - 15,9 ng.g-1); hepatopancreas (5,1 - 22,0 ng.g-1) and exoskeleton (3,0 - 16,2 ng.g-1), Hg concentrations were significantly lower in the outdoor trials submitted to Hg-poor aquafeeds. Maximum shrimp muscle Hg concentrations were low (36.4 ng.g-1 w.w.) relative to maximum permissible concentrations for human consumption and Hg content in muscle and hepatopancreas were significantly correlated with Hg content in aquafeeds. Highest Hg concentrations in the exoskeleton of animals exposed to Hg-richer aquafeed, suggested that a detoxification mechanism is taking place. On the other hand the metallothionein suffered no variation in its relative expression in any of the experiments, meaning that the contact with feed containing the observed Hg concentrations were not sufficient to activate gene transcription. It was not possible, under the experimental design used, to infer Hg effects on the biological performance of the animals.

The phases of embryonic development of Anodontites trapesialis lasidia are described for the first time. Adult specimens were obtained from two fish farms located in Londrina, Paraná, Brazil. The internal demibranchs of 120 individuals were studied using a routine histological technique; 70 of these carried eggs and/or larvae in the marsupium and were utilized for the description of the phases of embryonic development. The demibranchs of five specimens were evaluated by scanning electron microscopy to detail the morphology of the larvae. Five phases of development were established: phase I, corresponding to the initial stage of cleavage with the formation of apical cells; phase II, including the stages of the morula and blastula; phase III, where the gastrula forms; phase IV, where the larva formed is still inside the egg envelope; and phase V, where the lasidium can still be identified immediately after eclosion.

The current information on the branchiuran Dolops bidentata, a species described more one hundred years ago, is valid but incomplete; hence, an expanded description is given herein. Additional morphological information was obtained by light and scanning electron microscopy from specimens collected on Pygocentrus nattereri from the Poconé Wetland, MT, Brazil. Description of the appendages and other structures such as respiratory area, mouth, details and ornamentation of antennules and maxillae are provided for the first time.

The geometric morphometric analysis of the shell of Caretta caretta hatchlings revealed that morphological variations may be related to incubation duration. Based on the overlapping of anatomical landmarks of the carapace and the plastron, it was possible to discriminate hatchlings from slow and fast developing clutches. Carapace and plastron of hatchlings from nests where incubation lasted less than 55 days are rounder as compared to the hatchlings from nests where incubation took 67 days. The differences observed in shell shape in terms of incubation duration were statistically significant, though carapace and plastron shape overlapping was observed in several individuals. Our results indicate that the incubation duration explains only a small part of the total variation in the shell shape as a whole. Yet, in spite of the low discriminant function coefficient, cross-validation tests indicated that 84.7% and 77.8% of the hatchlings were correctly categorised concerning the carapace and plastron, when the descriptive variable is incubation duration.

The aim of this study was to describe and classify the food preference of fish species in Passa Cinco stream. The grade of feeding preference was applied to stomachs considered replete. This method consists of attributing values to food items found in certain species, according to the participation of each item in the analysed stomach. We analysed 576 full stomachs of 28 species. The autochthonous insects were the main constituents of the diets of these species, and the majority of ingested items classified as occasional. Allochthonous items such as plant debris, seeds and earthworms were associated with higher-order site. Of the total possible combination pairs of species, 29.4% showed high overlap, wich occurred mainly within species that consumed aquatic insect larvae. However, those species showed significant differences in the exploitation of food resources. Omnivory was common, showing the plasticity of the required species that inhabit environments as found in streams.

Synadenium umbellatum Pax, popularly known as "cola-nota", is a medicinal plant that grows in tropical regions. The latex of this plant is used against various diseases, such as diabetes mellitus, leprosy, tripanosomiasis, leukemia, and several malignant tumors. The mutagenic, antimutagenic, and cytotoxic effects of the latex of this plant were investigated by measuring the frequency of micronuclei in mice bone marrow cells. To evaluate mutagenicity, the animals were treated with four doses of latex (10, 30, 50, and 100 mg/kg body weight). To study the antimutagenic activity, the animals were simultaneously treated with latex and mitomycin C (4 mg/kg). The cytotoxicity was evaluated by polychromatic and normochromatic erythrocytes ratio. Our results showed a significant increase of frequency of micronucleated polychromatic erythrocytes (MNPCE) compared to the negative control group (p < 0.05). Concerning antimutagenicity, the doses of 10 and 30 mg/kg co-administered with mitomycin C showed significant decrease in MNPCE frequency compared to the positive control group (p < 0.05). However, no significant reduction in MNPCE frequency (p &gt; 0.05) was detected at the doses of 50 and 100 mg/kg. Under our experimental conditions, the results obtained indicate strong mutagenic and cytotoxic activity of S. umbellatum latex except the dose of 10 mg/kg and moderate antimutagenic effect at lower doses.

A new species of Heredius Marsh, 2002 is described from Brazil. H. flavus n. sp. differs from the other known Heredius species by its yellow mesosoma and metasoma, acinose-carinate face, acinose temple, malar space length about 0.56 times eye height, ocello-ocular distance about 4.0 times diameter of the lateral ocellus; acinose-rugose mesoscutal lobes, sternaulus finely scrobiculate and almost complete, and first metasomal tergum with apical width almost equal its length.